Stem-loop sequence cpi-mir-1306

AccessionMI0029587 (change log)
DescriptionChrysemys picta miR-1306 stem-loop
Stem-loop
   ---   acag  uc       uccccu  a        gug  gc 
5'    uga    cc  caccacc      gc aacgucca   ac  a
      |||    ||  |||||||      || ||||||||   ||   
3'    acu    gg  guggugg      cg uugcaggu   ug  g
   uag   gaca  ua       ---ucu  g        -aa  ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK082996.1: 3849507-3849591 [+]
intergenic
Clustered miRNAs
< 10kb from cpi-mir-1306
cpi-mir-3618KK082996.1: 3849196-3849272 [+]
cpi-mir-1306KK082996.1: 3849507-3849591 [+]
Database links

Mature sequence cpi-miR-1306-5p

Accession MIMAT0037910
Sequence

14 - 

ccaccuccccugcaaacgucca

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-1306-3p

Accession MIMAT0037911
Sequence

51 - 

uggacguuggcucugguggugau

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).