Stem-loop sequence cpi-mir-875

AccessionMI0029586 (change log)
DescriptionChrysemys picta miR-875 stem-loop
Stem-loop
            u  aau        cuuau      uucu 
5' guuuagugg ac   accucagu     caggug    a
   ||||||||| ||   ||||||||     ||||||    u
3' caagucacu ug   uggaguca     guccac    a
            u  agu        aaaac      uuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK082925.1: 9554505-9554583 [-]
intergenic
Clustered miRNAs
< 10kb from cpi-mir-875
cpi-mir-875KK082925.1: 9554505-9554583 [-]
cpi-mir-599KK082925.1: 9554355-9554443 [-]
Database links

Mature sequence cpi-miR-875-5p

Accession MIMAT0037909
Sequence

13 - 

aauaccucagucuuaucaggu

 - 33

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).