Stem-loop sequence cpi-mir-737

AccessionMI0029585 (change log)
DescriptionChrysemys picta miR-737 stem-loop
Stem-loop
   --   -  c   u  ua                     auua   c 
5'   cua cu ugc gu  uuuuuuuagguuuugauuuuu    cau u
     ||| || ||| ||  |||||||||||||||||||||    |||  
3'   gau ga acg cg  aaagaaauccaaaacuaaaag    gua u
   ua   a  a   u  ua                     ---c   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK083060.1: 542981-543068 [-]
intergenic
Database links

Mature sequence cpi-miR-737-5p

Accession MIMAT0037908
Sequence

14 - 

auuuuuuuagguuuugauuuuu

 - 35

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).