Stem-loop sequence cpi-mir-726

AccessionMI0029584 (change log)
DescriptionChrysemys picta miR-726 stem-loop
Stem-loop
   -u       u    ag  a   c      uc      a   a a 
5'   ggggcgu cacc  ga uuc gcuagu  ugaacu uuu c c
     ||||||| ||||  || ||| ||||||  |||||| ||| |  
3'   ccccgcg gugg  cu aag cgauca  acuuga aaa g u
   cc       c    -g  c   a      uc      a   a u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK083626.1: 84730-84817 [-]
intergenic
Database links

Mature sequence cpi-miR-726-3p

Accession MIMAT0037907
Sequence

55 - 

uucacuacuagcagaacucg

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).