Stem-loop sequence cpi-mir-551-1

AccessionMI0029581 (change log)
DescriptionChrysemys picta miR-551-1 stem-loop
Stem-loop
   u       aua       g         a      gga     uu   u 
5'  uuccugu   ugaccuu gaaaucaag augggu   gccug  gaa u
    |||||||   ||||||| ||||||||| ||||||   |||||  |||  
3'  agggacg   acuggga cuuugguuc uaccca   cggau  cuu a
   a       ---       a         a      --g     --   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
chr19: 8963570-8963662 [+]
intergenic
Database links

Mature sequence cpi-miR-551-5p

Accession MIMAT0037903
Sequence

20 - 

gaaaucaagaauggguggagccu

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-551-3p

Accession MIMAT0037904
Sequence

59 - 

gcgacccauacuugguuucaag

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).