Stem-loop sequence cpi-mir-490

AccessionMI0029579 (change log)
DescriptionChrysemys picta miR-490 stem-loop
Stem-loop
   ucauaa  uc           c      --         g   caag   a 
5'       gu  augguucgaca caugga  ucuccaggu ggu    auu u
         ||  ||||||||||| ||||||  ||||||||| |||    ||| a
3'       ca  ugucgaguugu guaccu  ggaggucca cca    uag g
   ----aa  cu           c      ca         a   --ca   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK082981.1: 1092841-1092937 [+]
intergenic
Database links

Mature sequence cpi-miR-490-5p

Accession MIMAT0037899
Sequence

22 - 

ccauggaucuccaggugggu

 - 41

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-490-3p

Accession MIMAT0037900
Sequence

61 - 

caaccuggaggacuccaugcugu

 - 83

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).