Stem-loop sequence cpi-mir-456

AccessionMI0029573 (change log)
DescriptionChrysemys picta miR-456 stem-loop
Stem-loop
   ----  u        g   g     uu       acau ug    c 
5'     ug auguguga cag caucu  ucagccu    g  gauu c
       || |||||||| ||| |||||  |||||||    |  ||||  
3'     ac ugcauacu guu guaga  ggucgga    c  cuaa u
   gucu  u        -   g     uu       ---- gu    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
chr3: 16069409-16069493 [+]
intergenic
Database links

Mature sequence cpi-miR-456-3p

Accession MIMAT0037889
Sequence

52 - 

caggcugguuagaugguuguc

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).