Stem-loop sequence cpi-mir-455

AccessionMI0029572 (change log)
DescriptionChrysemys picta miR-455 stem-loop
Stem-loop
   ----u  c   u ug  g          u      a   c   gaa 
5'      cc ugg g  ag guaugugccc uggacu cau gug   g
        || ||| |  || |||||||||| |||||| ||| |||    
3'      gg acu c  uc cauauacggg accuga gua cac   c
   uauuu  a   c gu  a          u      c   c   gac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK082974.1: 1002607-1002696 [-]
intergenic
Database links

Mature sequence cpi-miR-455-5p

Accession MIMAT0037887
Sequence

16 - 

uaugugcccuuggacuacaucg

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-455-3p

Accession MIMAT0037888
Sequence

52 - 

augcaguccaugggcauauac

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).