Stem-loop sequence cpi-mir-383

AccessionMI0029563 (change log)
DescriptionChrysemys picta miR-383 stem-loop
Stem-loop
   a   -   c     -c  a      aa    a        --    gu 
5'  agu cac ugcuc  uc gaucag  ggug uuguggcu  uuga  a
    ||| ||| |||||  || ||||||  |||| ||||||||  ||||  g
3'  uca gug acgag  ag cugguc  ucac gacaccga  aauu  a
   -   u   a     aa  a      cg    -        cg    au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK082926.1: 8873731-8873823 [+]
intergenic
Database links

Mature sequence cpi-miR-383-5p

Accession MIMAT0037874
Sequence

17 - 

agaucagaaggugauuguggcu

 - 38

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).