Stem-loop sequence cpi-mir-375

AccessionMI0029562 (change log)
DescriptionChrysemys picta miR-375 stem-loop
Stem-loop
   -a   accu   c            u      cc   u    gaccu    u 
5'   gca    cug acuugccuggcg cgagcc  acg gcaa     gacg g
     |||    ||| |||||||||||| ||||||  ||| ||||     ||||  
3'   ugu    gac uggacggauugc gcucgg  ugc uguu     uugc a
   gc   --cc   c            -      cu   u    -----    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK082919.1: 1101171-1101267 [+]
intergenic
Database links

Mature sequence cpi-miR-375-3p

Accession MIMAT0037873
Sequence

58 - 

uuuguucguucggcucgcguua

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).