Stem-loop sequence cpi-mir-302a

AccessionMI0029552 (change log)
DescriptionChrysemys picta miR-302a stem-loop
Stem-loop
   agcuuaa   acc -   c    uu                     - u 
5'        agg   c cca uacu  aauguggaaguacuugcuuug c c
          |||   | ||| ||||  ||||||||||||||||||||| |  
3'        ucc   g ggu guga  uuguaccuucgugaaugaaau g c
   ------g   aaa u   a    uu                     a u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK082956.1: 5875601-5875692 [-]
intergenic
Clustered miRNAs
< 10kb from cpi-mir-302a
cpi-mir-302bKK082956.1: 5876249-5876332 [-]
cpi-mir-302cKK082956.1: 5875986-5876065 [-]
cpi-mir-302aKK082956.1: 5875601-5875692 [-]
cpi-mir-302dKK082956.1: 5875126-5875204 [-]
cpi-mir-367KK082956.1: 5874433-5874528 [-]
Database links

Mature sequence cpi-miR-302a-3p

Accession MIMAT0037860
Sequence

58 - 

uaagugcuuccauguuuuagug

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).