Stem-loop sequence cpi-mir-301a

AccessionMI0029550 (change log)
DescriptionChrysemys picta miR-301a stem-loop
Stem-loop
   ug     aa  a     c    ---u          ----a       
5'   cugcu  cg augcu ugac    uuauugcacu     cuguac 
     |||||  || ||||| ||||    ||||||||||     ||||| u
3'   gacga  gu uacga acug    gauaacguga     gacauu 
   ga     aa  c     a    uuau          cgauc       
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK088184.1: 245711-245798 [-]
intergenic
Clustered miRNAs
< 10kb from cpi-mir-301a
cpi-mir-130dKK088184.1: 246998-247094 [-]
cpi-mir-301aKK088184.1: 245711-245798 [-]
Database links

Mature sequence cpi-miR-301a-3p

Accession MIMAT0037858
Sequence

52 - 

cagugcaauaguauugucaaagc

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).