Stem-loop sequence cpi-mir-223

AccessionMI0029549 (change log)
DescriptionChrysemys picta miR-223 stem-loop
Stem-loop
   --u    -    g    cc u                --g    a   u 
5'    gcag ugcu cgcu  g guauuugacaagcuga   uuug cac c
      |||| |||| ||||  | ||||||||||||||||   |||| ||| a
3'    cguu acga guga  c cauaaacuguuugacu   agac gug a
   auu    u    a    ac c                gug    g   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK083044.1: 1602018-1602113 [+]
intergenic
Database links

Mature sequence cpi-miR-223-5p

Accession MIMAT0037856
Sequence

16 - 

cguguauuugacaagcugaguuu

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-223-3p

Accession MIMAT0037857
Sequence

58 - 

ugucaguuugucaaauacccca

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).