Stem-loop sequence cpi-mir-222b

AccessionMI0029548 (change log)
DescriptionChrysemys picta miR-222b stem-loop
Stem-loop
   ----     a  ug cu             -     gau    c  acau 
5'     gaugc au  g  gcucaguagucgg uguag   cugu ug    u
       ||||| ||  |  ||||||||||||| |||||   |||| ||     
3'     cuacg ua  c  ugggucauuaguc acauc   gaca ac    a
   acua     a  gu ac             u     ---    -  cauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK082974.1: 415673-415765 [+]
intergenic
Database links

Mature sequence cpi-miR-222b-5p

Accession MIMAT0037854
Sequence

13 - 

ugcucaguagucgguguaggauc

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-222b-3p

Accession MIMAT0037855
Sequence

56 - 

agcuacaucugauuacuggguca

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).