Stem-loop sequence cpi-mir-221

AccessionMI0029546 (change log)
DescriptionChrysemys picta miR-221 stem-loop
Stem-loop
   -      uugg   a    -  ug   u         aauu    -   u 
5'  ccaggu    ggc ugaa cc  gca acaauguag    cugu guu g
    ||||||    ||| |||| ||  ||| |||||||||    |||| ||| u
3'  gguccg    ucg acuu gg  cgu uguuacauc    gaca cga u
   a      ----   a    u  gu   c         ----    a   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK082977.1: 2887913-2888004 [-]
intergenic
Clustered miRNAs
< 10kb from cpi-mir-221
cpi-mir-222aKK082977.1: 2888524-2888615 [-]
cpi-mir-221KK082977.1: 2887913-2888004 [-]
Database links

Mature sequence cpi-miR-221-5p

Accession MIMAT0037850
Sequence

18 - 

accuggcauacaauguagaauu

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-221-3p

Accession MIMAT0037851
Sequence

58 - 

agcuacauugucugcuggguuu

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).