Stem-loop sequence cpi-mir-218-2

AccessionMI0029543 (change log)
DescriptionChrysemys picta miR-218-2 stem-loop
Stem-loop
   -  g        uuu         cu        ------g   ga 
5'  ug gguuuucc   gugcuugau  aaccaugu       gua  a
    || ||||||||   |||||||||  ||||||||       |||   
3'  ac ucggaagg   cacgaacug  uugguaca       cau  c
   u  g        uac         uc        aguuaaa   aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK088198.1: 11351103-11351189 [-]
intergenic
Database links

Mature sequence cpi-miR-218-5p

Accession MIMAT0037846
Sequence

13 - 

uugugcuugaucuaaccaugug

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-218-3p

Accession MIMAT0037847
Sequence

53 - 

aacaugguucugucaagcac

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).