Stem-loop sequence cpi-mir-217

AccessionMI0029541 (change log)
DescriptionChrysemys picta miR-217 stem-loop
Stem-loop
   --a    ---uu     c c  a  c     c          --   auaa 
5'    guuu     gaugu g ag ua ugcau aggaacugau  ugg    u
      ||||     ||||| | || || ||||| ||||||||||  |||    a
3'    cgaa     cuacg c uc gu acgua uccuugacua  acc    a
   cua    cauau     a u  c  u     a          cc   gacu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK083117.1: 201885-201982 [-]
intergenic
Database links

Mature sequence cpi-miR-217-5p

Accession MIMAT0037845
Sequence

19 - 

uacugcaucaggaacugauugg

 - 40

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).