Stem-loop sequence cpi-mir-214

AccessionMI0029537 (change log)
DescriptionChrysemys picta miR-214 stem-loop
Stem-loop
     ac  a           u          aca            aacau 
5' gg  gg guugucaugug cugccugucu   cuugcugugcag     c
   ||  || ||||||||||| ||||||||||   ||||||||||||     c
3' cc  cc caacaguacac gacggacaga   ggacgacauguc     u
     ga  -           u          cac            cacuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK083408.1: 204476-204575 [-]
intergenic
Clustered miRNAs
< 10kb from cpi-mir-214
cpi-mir-199-2KK083408.1: 211169-211261 [-]
cpi-mir-214KK083408.1: 204476-204575 [-]
Database links

Mature sequence cpi-miR-214-5p

Accession MIMAT0037839
Sequence

22 - 

gccugucuacacuugcugugc

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-214-3p

Accession MIMAT0037840
Sequence

61 - 

uacagcaggcacagacaggcag

 - 82

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).