Stem-loop sequence cpi-mir-212

AccessionMI0029536 (change log)
DescriptionChrysemys picta miR-212 stem-loop
Stem-loop
   g   gc  g    -ca  u     c       a      cuaaguag 
5'  uca  gc ucgg   cc uggcu uagacug uuacug        c
    |||  || ||||   || ||||| ||||||| ||||||        a
3'  agu  cg aguc   gg acuga aucugac aaugac        u
   -   -a  a    auc  u     c       -      aaagaaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK083788.1: 25119-25211 [-]
intergenic
Clustered miRNAs
< 10kb from cpi-mir-212
cpi-mir-212KK083788.1: 25119-25211 [-]
cpi-mir-132KK083788.1: 18748-18835 [-]
cpi-mir-2184KK083788.1: 17035-17128 [+]
Database links

Mature sequence cpi-miR-212-5p

Accession MIMAT0037838
Sequence

15 - 

accuuggcucuagacugauua

 - 35

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).