Stem-loop sequence cpi-mir-210

AccessionMI0029535 (change log)
DescriptionChrysemys picta miR-210 stem-loop
Stem-loop
   ----c          g    a   acua       u  --ug  g 
5'      agaagcuggu agcc cug    acgcaca ug    cu u
        |||||||||| |||| |||    ||||||| ||    || u
3'      uuuucgacca ucgg gac    ugcgugu ac    ga a
   ccggc          a    c   agug       c  cuaa  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK083161.1: 870670-870756 [+]
intergenic
Database links

Mature sequence cpi-miR-210-5p

Accession MIMAT0037836
Sequence

13 - 

agccacugacuaacgcacauug

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-210-3p

Accession MIMAT0037837
Sequence

52 - 

cugugcgugugacagcggcuaa

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).