Stem-loop sequence cpi-mir-206

AccessionMI0029533 (change log)
DescriptionChrysemys picta miR-206 stem-loop
Stem-loop
   --u       u     a                cc     ugaau 
5'    ucucuuu gagac acaugcuucuuuauau  ccaua     u
      ||||||| ||||| ||||||||||||||||  |||||     a
3'    agaggga cuuug ugugugaaggaaugua  gguau     u
   agu       -     g                -a     cgucg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK088210.1: 11554133-11554221 [+]
intergenic
Clustered miRNAs
< 10kb from cpi-mir-206
cpi-mir-206KK088210.1: 11554133-11554221 [+]
cpi-mir-133bKK088210.1: 11559703-11559797 [+]
Database links

Mature sequence cpi-miR-206-5p

Accession MIMAT0037833
Sequence

16 - 

acaugcuucuuuauauccccau

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-206-3p

Accession MIMAT0037834
Sequence

54 - 

uggaauguaaggaagugugugg

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).