Stem-loop sequence cpi-mir-205b

AccessionMI0029532 (change log)
DescriptionChrysemys picta miR-205b stem-loop
Stem-loop
   -      gcuug      cc       c   c        uagag 
5'  uccaug     cuggug  cuucauu cac ggaaucug     g
    ||||||     ||||||  ||||||| ||| ||||||||     c
3'  agguac     gacuac  gaaguaa gug cuuuagac     a
   a      ----a      cc       u   a        caaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK082943.1: 585599-585686 [+]
intergenic
Database links

Mature sequence cpi-miR-205b-5p

Accession MIMAT0037832
Sequence

18 - 

cccuucauuccaccggaaucugu

 - 40

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).