Stem-loop sequence cpi-mir-205a

AccessionMI0029531 (change log)
DescriptionChrysemys picta miR-205a stem-loop
Stem-loop
   a      aau   g    c           c        ucuca 
5'  uccaug   ucu uugu cuucauuccac ggagucug     u
    ||||||   ||| |||| ||||||||||| ||||||||     a
3'  agguac   aga aaca gaagugaggug cuuuagac     a
   g      ---   g    c           a        uaauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK082997.1: 2704853-2704940 [-]
intergenic
Database links

Mature sequence cpi-miR-205a-5p

Accession MIMAT0037830
Sequence

18 - 

uccuucauuccaccggagucug

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-205a-3p

Accession MIMAT0037831
Sequence

55 - 

gauuucaguggagugaagcaca

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).