Stem-loop sequence cpi-mir-204-3

AccessionMI0029530 (change log)
DescriptionChrysemys picta miR-204-3 stem-loop
Stem-loop
   cc    c   c    a         ug  a     u   - g  ag 
5'   ggug gcc ugug gcuucccuu  uc uccua gcc u ag  a
     |||| ||| |||| |||||||||  || ||||| ||| | ||   
3'   ccgu cgg gcac cgaagggaa  gg agggu cgg g uc  u
   aa    -   u    c         gu  c     -   a g  cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK082985.1: 2910505-2910595 [-]
intergenic
Database links

Mature sequence cpi-miR-204-5p

Accession MIMAT0037827
Sequence

19 - 

uucccuuugucauccuaugccu

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-204-3-3p

Accession MIMAT0037829
Sequence

56 - 

gcugggacggugaagggaagc

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).