Stem-loop sequence cpi-mir-199-3

AccessionMI0029523 (change log)
DescriptionChrysemys picta miR-199-3 stem-loop
Stem-loop
   gc    - u c     c       u        c   u   gacu 
5'   ucca c c gucug ccagugu cagacuac ugu cag    a
     |||| | | ||||| ||||||| |||||||| ||| |||     
3'   gggu g g cggau gguuaca gucugaug aca guu    c
   -a    c u u     u       c        -   u   agag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK082938.1: 6508778-6508866 [-]
intergenic
Database links

Mature sequence cpi-miR-199-5p

Accession MIMAT0037818
Sequence

16 - 

cccaguguucagacuaccug

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-199-3p

Accession MIMAT0037819
Sequence

55 - 

acaguagucugcacauugguua

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).