Stem-loop sequence cpi-mir-199-2

AccessionMI0029522 (change log)
DescriptionChrysemys picta miR-199-2 stem-loop
Stem-loop
   -ga    -    c   gcc       u        c   ---u   ga 
5'    uccu gcuc guc   ccagugu cagacuac ugu    cag  c
      |||| |||| |||   ||||||| |||||||| |||    |||  a
3'    ggga cggg cag   gguuaca gucugaug aca    guc  a
   aaa    a    u   auu       c        -   uguu   gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK083408.1: 211169-211261 [-]
intergenic
Clustered miRNAs
< 10kb from cpi-mir-199-2
cpi-mir-199-2KK083408.1: 211169-211261 [-]
cpi-mir-214KK083408.1: 204476-204575 [-]
Database links

Mature sequence cpi-miR-199-5p

Accession MIMAT0037818
Sequence

17 - 

cccaguguucagacuaccug

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-199-3p

Accession MIMAT0037819
Sequence

56 - 

acaguagucugcacauugguua

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).