Stem-loop sequence cpi-mir-199-1

AccessionMI0029521 (change log)
DescriptionChrysemys picta miR-199-1 stem-loop
Stem-loop
   -    -    gc   c       u        c   u  ---g  g 
5'  ccag ccca  cug ccagugu cagacuac ugu ca    ga g
    |||| ||||  ||| ||||||| |||||||| ||| ||    || c
3'  gguu gggu  gau gguuaca gucugaug aca gu    cu u
   u    u    ua   u       c        -   u  ggaa  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK083214.1: 569144-569232 [+]
intergenic
Database links

Mature sequence cpi-miR-199-5p

Accession MIMAT0037818
Sequence

14 - 

cccaguguucagacuaccug

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-199-3p

Accession MIMAT0037819
Sequence

55 - 

acaguagucugcacauugguua

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).