Stem-loop sequence cpi-mir-196-3

AccessionMI0029520 (change log)
DescriptionChrysemys picta miR-196-3 stem-loop
Stem-loop
   -c   ---g     uucu      u          a      u    cucc 
5'   uga    aacug    guaguu agguaguuuc uguugu gggg    a
     |||    |||||    |||||| |||||||||| |||||| ||||    c
3'   acu    uugac    cauuaa uccgucaaag acgacg cucu    c
   cu   aaag     --uu      u          c      u    cuuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
chr2: 12274641-12274739 [-]
intergenic
Database links

Mature sequence cpi-miR-196-5p

Accession MIMAT0037815
Sequence

21 - 

uagguaguuucauguuguuggg

 - 42

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).