Stem-loop sequence cpi-mir-194-1

AccessionMI0029516 (change log)
DescriptionChrysemys picta miR-194-1 stem-loop
Stem-loop
   --     -u       u         a      g    cuac 
5'   cagug  uaucaga guaacagca cuccau ugga    a
     |||||  ||||||| ||||||||| |||||| ||||    c
3'   gucau  auaguuu cauugucgu gaggug accu    u
   ca     cu       u         a      -    ucag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK088190.1: 1310613-1310695 [+]
intergenic
Clustered miRNAs
< 10kb from cpi-mir-194-1
cpi-mir-194-1KK088190.1: 1310613-1310695 [+]
cpi-mir-215KK088190.1: 1310931-1311017 [+]
Database links

Mature sequence cpi-miR-194-5p

Accession MIMAT0037812
Sequence

14 - 

uguaacagcaacuccaugugga

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-194-3p

Accession MIMAT0037813
Sequence

48 - 

ccaguggagaugcuguuacuu

 - 68

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).