Stem-loop sequence cpi-mir-190b

AccessionMI0029511 (change log)
DescriptionChrysemys picta miR-190b stem-loop
Stem-loop
   u  --     c      cu  -             a     -    a 
5'  gc  cccug cgcugg  ga uauguuugauauu gguug uuuu u
    ||  ||||| ||||||  || ||||||||||||| ||||| |||| u
3'  cg  gggac gcggcc  cu auacaaacuauaa ucaac aaaa g
   u  cc     c      uu  u             a     c    g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK083007.1: 244247-244339 [+]
intergenic
Database links

Mature sequence cpi-miR-190b-5p

Accession MIMAT0037805
Sequence

17 - 

ugauauguuugauauuagguug

 - 38

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).