Stem-loop sequence cpi-mir-181b-3

AccessionMI0029505 (change log)
DescriptionChrysemys picta miR-181b-3 stem-loop
Stem-loop
   ---cgaaa       aucaa         cu           gug  gu 
5'         agucaca     cauucauug  gucgguggguu   uu  u
           |||||||     |||||||||  |||||||||||   ||   
3'         uuagugu     guaaguaac  uagucacucaa   gg  g
   agguaagg       -caac         --           aaa  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK088216.1: 221988-222081 [-]
intergenic
Clustered miRNAs
< 10kb from cpi-mir-181b-3
cpi-mir-181a-3KK088216.1: 223346-223434 [-]
cpi-mir-181b-3KK088216.1: 221988-222081 [-]
Database links

Mature sequence cpi-miR-181b-5p

Accession MIMAT0037795
Sequence

16 - 

aacauucauugcugucgguggguu

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-181b-3p

Accession MIMAT0037797
Sequence

58 - 

cucacugaucaaugaaugca

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).