Stem-loop sequence cpi-mir-153-2

AccessionMI0029497 (change log)
DescriptionChrysemys picta miR-153-2 stem-loop
Stem-loop
   -      g      -             gu       -a  aa 
5'  gcgguu ccagug ucauuuuugugau  ugcagcu  gu  u
    |||||| |||||| |||||||||||||  |||||||  ||  a
3'  ugucaa gguuac agugaaaacacug  acguuga  cg  u
   g      a      u             au       cc  ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK088209.1: 20659248-20659333 [+]
intergenic
Database links

Mature sequence cpi-miR-153-3p

Accession MIMAT0037788
Sequence

52 - 

uugcauagucacaaaaguga

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).