Stem-loop sequence cpi-mir-153-1

AccessionMI0029496 (change log)
DescriptionChrysemys picta miR-153-1 stem-loop
Stem-loop
   -----ca           -             -       a uaau 
5'        gcugccagugc cauuuuugugauu ugcagcu g    c
          ||||||||||| ||||||||||||| ||||||| |     
3'        cgacgguuacg gugaaaacacuga acguuga c    u
   uccgugc           a             u       c uggg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK082919.1: 338336-338422 [+]
intergenic
Database links

Mature sequence cpi-miR-153-5p

Accession MIMAT0037787
Sequence

13 - 

ccauuuuugugauuugcagcu

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-153-3p

Accession MIMAT0037788
Sequence

50 - 

uugcauagucacaaaaguga

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).