Stem-loop sequence cpi-mir-152

AccessionMI0029495 (change log)
DescriptionChrysemys picta miR-152 stem-loop
Stem-loop
   ---    -   cg             g  a    ug    ug a  c 
5'    gucc ucu  gcccagguucugu gu cacu  gacu  g cu u
      |||| |||  ||||||||||||| || ||||  ||||  | ||  
3'    cagg agg  uggguucaagaca ua guga  cuga  c ga g
   ucc    u   uu             g  c    --    -- -  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK088207.1: 3033148-3033234 [+]
intergenic
Database links

Mature sequence cpi-miR-152-5p

Accession MIMAT0037785
Sequence

14 - 

agguucugugguacacuuggacu

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-152-3p

Accession MIMAT0037786
Sequence

52 - 

ucagugcaugacagaacuugg

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).