Stem-loop sequence cpi-mir-145

AccessionMI0029488 (change log)
DescriptionChrysemys picta miR-145 stem-loop
Stem-loop
   ------------   u        uc    u  c            uagg a 
5'             gug ccucaggg  cagu uu ccaggaaucccu    c c
               ||| ||||||||  |||| || ||||||||||||    | u
3'             uac ggaguucu  guca aa gguccuuagggg    g a
   ucgacgacucgg   c        -u    u  a            --ca u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK088198.1: 3606854-3606945 [+]
intergenic
Clustered miRNAs
< 10kb from cpi-mir-145
cpi-mir-143KK088198.1: 3605724-3605824 [+]
cpi-mir-145KK088198.1: 3606854-3606945 [+]
Database links

Mature sequence cpi-miR-145-5p

Accession MIMAT0037772
Sequence

12 - 

guccaguuuucccaggaaucccu

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-145-3p

Accession MIMAT0037773
Sequence

50 - 

ggauuccuggaaauacuguucu

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).