Stem-loop sequence cpi-mir-142-2

AccessionMI0029485 (change log)
DescriptionChrysemys picta miR-142-2 stem-loop
Stem-loop
   --           c            a         uaaaccgc 
5'   acagugcacuc uccauaaaguag aagcacuac        c
     ||||||||||| |||||||||||| |||||||||         
3'   ugucaugugag agguauuucauc uuugugaug        g
   ag           u            c         ugcccugc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK083282.1: 271379-271466 [-]
intergenic
Database links

Mature sequence cpi-miR-142-5p

Accession MIMAT0037766
Sequence

15 - 

cauaaaguagaaagcacuacua

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-142-3p

Accession MIMAT0037767
Sequence

52 - 

uguaguguuuccuacuuuaugg

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).