Stem-loop sequence cpi-mir-142-1

AccessionMI0029484 (change log)
DescriptionChrysemys picta miR-142-1 stem-loop
Stem-loop
   ag        g   c           a         u aa a    
5'   acagugca uca ccauaaaguag aagcacuac a  c gca 
     |||||||| ||| ||||||||||| ||||||||| |  | || c
3'   ugucaugu agu gguauuucauc uuugugaug u  g cgu 
   -g        g   a           c         - gg a    
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK083155.1: 203958-204046 [-]
intergenic
Database links

Mature sequence cpi-miR-142-5p

Accession MIMAT0037766
Sequence

17 - 

cauaaaguagaaagcacuacua

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-142-3p

Accession MIMAT0037767
Sequence

54 - 

uguaguguuuccuacuuuaugg

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).