Stem-loop sequence cpi-mir-138

AccessionMI0029481 (change log)
DescriptionChrysemys picta miR-138 stem-loop
Stem-loop
   --     u u   u  ag       u     uca     acaacaagcu 
5'   gguau g ugc gc  cuggugu gugaa   ggccg          c
     ||||| | ||| ||  ||||||| |||||   |||||           
3'   ccaua c acg ug  gaccaca cacuu   ucggc          a
   ca     - u   u  -g       u     -ua     cuaucauccu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
chr15: 1379883-1379977 [-]
intergenic
Database links

Mature sequence cpi-miR-138-5p

Accession MIMAT0037760
Sequence

15 - 

agcugguguugugaaucaggc

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-138-3p

Accession MIMAT0037761
Sequence

62 - 

gcuauuucacuacaccagggu

 - 82

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).