Stem-loop sequence cpi-mir-135-1

AccessionMI0029476 (change log)
DescriptionChrysemys picta miR-135-1 stem-loop
Stem-loop
   --     c   c  c         uu            uuauac 
5'   uccca ugu uu uauggcuuu  auuccuauguga      u
     ||||| ||| || |||||||||  ||||||||||||       
3'   ggggu gca aa gugccgaag  uagggauauacu      g
   uc     c   u  c         -u            uuaauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK083011.1: 696089-696175 [-]
intergenic
Database links

Mature sequence cpi-miR-135-5p

Accession MIMAT0037754
Sequence

14 - 

uauggcuuuuuauuccuaugug

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-135-3p

Accession MIMAT0037755
Sequence

53 - 

auauagggauugaagccgugca

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).