Stem-loop sequence cpi-mir-133c

AccessionMI0029475 (change log)
DescriptionChrysemys picta miR-133c stem-loop
Stem-loop
   --    aga a       c   g       aaa    -a        aacuu 
5'   cugg   g guguguc cug ggcuggu   aagg  accagauc     g
     ||||   | ||||||| ||| |||||||   ||||  ||||||||      
3'   gacc   c uacgcgg gac ucgacca   uucc  ugguuuag     g
   cc    --g a       u   g       -ac    cc        gucaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
chr19: 4211024-4211123 [+]
intergenic
Clustered miRNAs
< 10kb from cpi-mir-133c
cpi-mir-1bchr19: 4210814-4210912 [+]
cpi-mir-133cchr19: 4211024-4211123 [+]
Database links

Mature sequence cpi-miR-133c-3p

Accession MIMAT0037753
Sequence

59 - 

uuugguccccuucaaccagcug

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).