Stem-loop sequence cpi-mir-132

AccessionMI0029471 (change log)
DescriptionChrysemys picta miR-132 stem-loop
Stem-loop
   ---     --  ag   a         u             uggu 
5'    ugucu  cc  ggc accguggcu uagauuguuacug    u
      |||||  ||  ||| ||||||||| |||||||||||||    g
3'    acaga  gg  ucg ugguaccga aucugacaauggu    u
   cac     uc  gu   c         c             ugug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK083788.1: 18748-18835 [-]
intergenic
Clustered miRNAs
< 10kb from cpi-mir-132
cpi-mir-212KK083788.1: 25119-25211 [-]
cpi-mir-132KK083788.1: 18748-18835 [-]
cpi-mir-2184KK083788.1: 17035-17128 [+]
Database links

Mature sequence cpi-miR-132-5p

Accession MIMAT0037748
Sequence

14 - 

accguggcuuuagauuguuacu

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-132-3p

Accession MIMAT0037749
Sequence

51 - 

uaacagucuacagccauggucg

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).