Stem-loop sequence cpi-mir-130d

AccessionMI0029470 (change log)
DescriptionChrysemys picta miR-130d stem-loop
Stem-loop
   a ug     --  u             u          a  ---a   au 
5'  g  guguc  ug ccagugcccuuuu auguuguacu cu    gug  c
    |  |||||  || ||||||||||||| |||||||||| ||    |||   
3'  u  cauag  ac gguuacgggaaaa uguaacguga ga    cac  a
   c gu     ug  c             u          c  aaaa   au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK088184.1: 246998-247094 [-]
intergenic
Clustered miRNAs
< 10kb from cpi-mir-130d
cpi-mir-130dKK088184.1: 246998-247094 [-]
cpi-mir-301aKK088184.1: 245711-245798 [-]
Database links

Mature sequence cpi-miR-130d-3p

Accession MIMAT0037747
Sequence

60 - 

agugcaauguuaaaagggcauu

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).