Stem-loop sequence cpi-mir-129-2

AccessionMI0029466 (change log)
DescriptionChrysemys picta miR-129-2 stem-loop
Stem-loop
   gu           -       c   cu      g   ua  uaa 
5'   ccuucgcgaau cuuuuug ggu  gggcuu cug  ua   c
     ||||||||||| ||||||| |||  |||||| |||  ||    
3'   ggaggcgcuua gaaaaac cca  cccgaa ggc  au   u
   -g           c       c   uu      g   cg  cca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
chr4: 24483318-24483405 [+]
intergenic
Database links

Mature sequence cpi-miR-129-5p

Accession MIMAT0037738
Sequence

14 - 

cuuuuugcggucugggcuugc

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-129-2-3p

Accession MIMAT0037740
Sequence

57 - 

aagcccuuaccccaaaaagca

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).