Stem-loop sequence cpi-mir-124-4

AccessionMI0029458 (change log)
DescriptionChrysemys picta miR-124-4 stem-loop
Stem-loop
   c cu       cg     c        a   ga        uaau 
5'  g  cggcuuc  cuuuu guguucac gcg  ccuugauu    u
    |  |||||||  ||||| |||||||| |||  ||||||||    u
3'  c  gccgaag  gagaa cguaagug cgc  ggaauuaa    c
   u ag       -a     c        g   ac        caua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK082935.1: 897991-898082 [+]
intergenic
Database links

Mature sequence cpi-miR-124-5p

Accession MIMAT0037726
Sequence

19 - 

cguguucacagcggaccuuga

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-124-3p

Accession MIMAT0037727
Sequence

56 - 

uaaggcacgcggugaaugcca

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).