Stem-loop sequence cpi-mir-103-1

AccessionMI0029449 (change log)
DescriptionChrysemys picta miR-103-1 stem-loop
Stem-loop
   ggaau u  cau       --    u  u           c   u g a 
5'      g cu   ugucuuc  ggcu cu uacagugcugc uug u c u
        | ||   |||||||  |||| || ||||||||||| ||| | |  
3'      c ga   acggaag  ucgg ga auguuacgacg aac a g a
   -cguu u  auu       ua    -  c           -   u g u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK088198.1: 11071784-11071878 [-]
intergenic
Database links

Mature sequence cpi-miR-103-3p

Accession MIMAT0037719
Sequence

57 - 

agcagcauuguacagggcuau

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).