Stem-loop sequence cpi-mir-96

AccessionMI0029442 (change log)
DescriptionChrysemys picta miR-96 stem-loop
Stem-loop
   uauc    -    g     u         g     uu      -uu   u 
5'     ucug cuuc cccgg uuggcacua cacau  uugcuu   gua a
       |||| |||| ||||| ||||||||| |||||  ||||||   |||  
3'     aggc gaag ggguc aaccgugau gugua  aacgag   cau a
   -uga    a    a     u         -     uu      uuu   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK083104.1: 1276766-1276863 [+]
intergenic
Clustered miRNAs
< 10kb from cpi-mir-96
cpi-mir-183KK083104.1: 1276366-1276464 [+]
cpi-mir-96KK083104.1: 1276766-1276863 [+]
Database links

Mature sequence cpi-miR-96-5p

Accession MIMAT0037707
Sequence

19 - 

uuuggcacuagcacauuuuugc

 - 40

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).