Stem-loop sequence cpi-mir-92a-2

AccessionMI0029438 (change log)
DescriptionChrysemys picta miR-92a-2 stem-loop
Stem-loop
   ---ugg             g     uu  u   u     gua  u 
5'       uuucuccaugggu gggau  gu gca uacuu   gc a
         ||||||||||||| |||||  || ||| |||||   || u
3'       aaggagguguccg cccug  ca cgu augag   ug g
   ggagga             g     uu  -   u     --a  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK088187.1: 4591087-4591173 [-]
intergenic
Clustered miRNAs
< 10kb from cpi-mir-92a-2
cpi-mir-106aKK088187.1: 4591728-4591805 [-]
cpi-mir-18bKK088187.1: 4591575-4591651 [-]
cpi-mir-20bKK088187.1: 4591349-4591443 [-]
cpi-mir-19b-2KK088187.1: 4591224-4591323 [-]
cpi-mir-92a-2KK088187.1: 4591087-4591173 [-]
cpi-mir-363KK088187.1: 4590949-4591039 [-]
Database links

Mature sequence cpi-miR-92a-2-5p

Accession MIMAT0037700
Sequence

15 - 

guggggauuuguugcauuacu

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-92a-3p

Accession MIMAT0037699
Sequence

53 - 

uauugcacuugucccggccu

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).