Stem-loop sequence cpi-mir-92a-1

AccessionMI0029437 (change log)
DescriptionChrysemys picta miR-92a-1 stem-loop
Stem-loop
   -   a    ---uu   ac            c   u        gu ug 
5'  ugu cccc     ucu  acagguugggau agu gcaaugcu  g  u
    ||| ||||     |||  |||||||||||| ||| ||||||||  |   
3'  aca gggg     gga  uguccggcccug uca cguuauga  u  g
   g   -    ugguu   gu            u   -        ug cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK083096.1: 1396547-1396640 [-]
intergenic
Clustered miRNAs
< 10kb from cpi-mir-92a-1
cpi-mir-17KK083096.1: 1397279-1397364 [-]
cpi-mir-18aKK083096.1: 1397132-1397220 [-]
cpi-mir-19aKK083096.1: 1396986-1397085 [-]
cpi-mir-20aKK083096.1: 1396807-1396898 [-]
cpi-mir-19b-1KK083096.1: 1396664-1396757 [-]
cpi-mir-92a-1KK083096.1: 1396547-1396640 [-]
Database links

Mature sequence cpi-miR-92a-5p

Accession MIMAT0037698
Sequence

18 - 

agguugggaucaguugcaaugcu

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-92a-3p

Accession MIMAT0037699
Sequence

55 - 

uauugcacuugucccggccu

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).