Stem-loop sequence cpi-mir-34b

AccessionMI0029435 (change log)
DescriptionChrysemys picta miR-34b stem-loop
Stem-loop
   --gaagua      -gg    ua       u      c        ucca 
5'         guguuu   uuug  ggcagug aguuag ugauugua    u
           ||||||   ||||  ||||||| |||||| ||||||||     
3'         cacaga   aaac  ccgucau ucaauc acuaacgu    c
   ccuuaaga      aca    ua       u      -        uucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK083019.1: 1773044-1773141 [-]
intergenic
Clustered miRNAs
< 10kb from cpi-mir-34b
cpi-mir-34bKK083019.1: 1773044-1773141 [-]
cpi-mir-34cKK083019.1: 1772337-1772422 [-]
Database links

Mature sequence cpi-miR-34b-5p

Accession MIMAT0037694
Sequence

20 - 

aggcaguguaguuagcugauug

 - 41

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-34b-3p

Accession MIMAT0037695
Sequence

58 - 

aucacuaacuuuacugccauc

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).