Stem-loop sequence cpi-mir-33-2

AccessionMI0029433 (change log)
DescriptionChrysemys picta miR-33-2 stem-loop
Stem-loop
   -  u    g  g   u  -          uu        ug g  a 
5'  ag ggcc ca cug gg ugcauuguag  gcauugca  u ug g
    || |||| || ||| || ||||||||||  ||||||||  | ||  
3'  uc ucgg gu gac cc acgugacguc  cguaacgu  g ac a
   u  u    g  a   -  g          cc        gu g  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK088234.1: 10369055-10369145 [-]
intergenic
Database links

Mature sequence cpi-miR-33-5p

Accession MIMAT0037689
Sequence

17 - 

gugcauuguaguugcauugca

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-33-2-3p

Accession MIMAT0037691
Sequence

56 - 

caaugccccugcagugcagcc

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).